Molecular Study on The Pathogenicity of Avian Influenza Virus

https://doi.org/10.22146/ijbiotech.7567

Haryadi M. Wibowo(1*), Heru Susetya(2), Tri Untari(3), Khrisdiana Putri(4), Charles Rangga Tabbu(5)

(1) 
(2) 
(3) 
(4) 
(5) 
(*) Corresponding Author

Abstract


Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) based
on multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose of
this work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from both
cases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primer
desaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-
R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenza
virus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic amino
acid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HA
genefragment indicated that each type of characteristic lesion created philo-groups.
Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.

Full Text:

PDF



DOI: https://doi.org/10.22146/ijbiotech.7567

Article Metrics

Abstract views : 2700 | views : 2396

Refbacks

  • There are currently no refbacks.


Copyright (c) 2015 Indonesian Journal of Biotechnology