A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis

https://doi.org/10.22146/ijbiotech.7409

S. Sumartono(1*)

(1) Parasitology Department, Faculty of Veterinary Medicine Gadjah Mada University, Jl. Olah RagaKarangmalang Yogyakarta 55281, Indonesia
(*) Corresponding Author

Abstract


The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe labeled with dig-11-dUTP, namely, 158,33 pg/µl, 52,25 pg/µl, 15,83 pg/µl and 5,225 pg/µl were tested to detect 0,6551 µg DNA target. The procedure of labeling and hybridization detection between DNA target with the molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection starter Kit I. The conclusion of the research was that 52,25 pg/µl molecular probe or more which its sequence GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA target by dot blot method.


Keywords


coccidiosis, E. tenella genome, molecular probe, dot blot hybridization

Full Text:

PDF


References

Anonim, 2001. http://www.cbs.dtu.dk/ d a t a b a s e / D O G S / abbr.table.common.txt

Barker, R.H., 1990. DNA probe diagnosis of parasitic infection. Exp. Parasitol., 70, 494-499.

Bowman, D., 2003. Georgis’ Parasitology for veterinarians. 8th ed. Saunders, 91-98. Calnek, B.W., Barnes, H.J., Beard, C.W., Reid, W.M. and Yorder, Jr.H.W., 1991. Disease of poultry. Month ed. Iowa , Ames, USA: The Iowa State University Press, 786-788.

Groves, P.J., 1986. Coccidiosis in chickens, turkey and ducks in poultry health., 36- 175.

Kaufmann, J., 1996. Parasitic infections of domestic animals. A diagnostic manual. Basel, Boston, Berlin: Birkhauser Verlog, 17-21 dan 341-347.

Keller, G.H and Manak, M.M., 1989. DNA probes. Macmillan Publisher Ltd, 1- 16.

Leitch, A.R., Schwarzacher,T., Jackson, D. and Leitch, I.J., 1994. In situ hybridation : a practical guide. Bios Scientific Publisher, 33

MacPherson, J.M and Gajadhar, A.A., 1993. Differentiation of seven Eimeria species by random amplified polymorphic DNA. Veterinary Parasitology. 45, 257-266.

Morgan, B.B. and Hawkins, P.A., 1995. Veterinary Protozoology. 2nd ed. Burgess Publishing Company Minnesota, 76- 79.

Reid, W.M., Long L and McDougald, L.R., 1984. Coccidiosis in disease of poultry. 8th ed. In Hoffstad, M.S., Barner, H.J., Calnek, B.W., Reid, W.M. and Yorder, H.W., ed. Iowa, USA: The Iowa State University Press, 693-708.

Reischsl, U., Bretagne, S., Kruger, D., Ernault, P. and Costa, J.M., 2003. Comparison of two DNA targets for the diagnosis of toxoplasmosis by real-time PCR using fluorescence resonance energy transfer hybridization probes. BMC. Infect. Dis., 3 (1), 7.

Roberts, L.S and Janovy, J., 2000. Foundation of Parasitology. MacGrawHill, 122-126.

Salehzada, T and Taha M.N., 1992. Licence de Biochemie. Biochemie des proteines. Biochemie Moleculaire. Travaux Practique de Biochemie Universite Montpellier II. U.F.R- S.F.A., 10-22.

Shirley, M.W., 2000. The genome of Eimeria spp. Special reference to Eimeria tenella, a coccidium from the chicken. Int. J. Parasit., 30, 485-493.

Soulsby, E.J.L., 1982. Helminths, Arthropods and protozoa of domesticated animal. 7th ed. London: Bailliere Tindall, 507- 645.

Sumartono, Widodo, D.P. dan Nurcahyo, W., 2004. Pengembangan probe molekuler untuk optimalisasi diagnosis koksidiosis. Laporan Penelitian Th. I HB XII.



DOI: https://doi.org/10.22146/ijbiotech.7409

Article Metrics

Abstract views : 7138 | views : 2885

Refbacks

  • There are currently no refbacks.


Copyright (c) 2015 Indonesian Journal of Biotechnology