Indonesian Journal of Pharmacy https://journal.ugm.ac.id/v3/IJP <p>Thank you for visiting the Indonesian Journal of Pharmacy (ISSN-e: 2338-9486, ISSN-p: 2338-9427), formerly Majalah Farmasi Indonesia (ISSN: 0126-103<a href="https://www.scopus.com/author/submit/profile.uri?authorId=7005939624&amp;origin=AuthorNamesList&amp;offset=1&amp;authorSt1=Kirsch&amp;authorSt2=Lee+E.&amp;resultsKey=AUTH_1530392577">7). The journal has been established in 1972, and online publication was begun in 2008. Since 2012, the journal has been published in English by Faculty of Pharmacy, Universitas Gadjah Mada (UGM), Yogyakart</a>a, Indonesia, in collaboration with Ikatan Apoteker Indonesia (IAI) or the Indonesian Pharmacist Association and since then we only receive manuscripts in English. The Indonesian Journal of Pharmacy is accredited by the Directorate General of Higher Education (DGHE) DIKTI of Indonesia with no. 30/E/KPT/2018.</p> Faculty of Pharmacy, Universitas Gadjah Mada en-US Indonesian Journal of Pharmacy 2338-9427 Delivery of Potential Drugs to The Colon: Challenges and Strategies https://journal.ugm.ac.id/v3/IJP/article/view/2734 <p style="text-align: justify;">Colon-targeted drug delivery systems have been exploited to treat local diseases in the colon, systemic delivery of protein and peptide, and chronotherapeutic drugs. The upper gastrointestinal tract restricts the effective delivery of these drugs. Therefore, several strategies are needed for targeted drugs directly to the colon, such as pH-sensitive polymers, enzyme-sensitive polymers, bacterially degradable polysaccharides, time-dependent polymers, and particulate systems. However, variable physiological conditions of the gastrointestinal tract in individuals cause combinations of these strategies are needed to ensure colonic delivery of the drug. This review presents and discusses several potential drugs and their approaches used to design and develop colon-targeted drug delivery systems for medications with particular characteristics.</p> Raditya Iswandana Kurnia Sari Setio Putri Sekar Arum Larasati Maxius Gunawan Fathia Amalia Putri Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 307 332 10.22146/ijp.2734 Somatostatin Analog-Based Radiopharmaceuticals for Molecular Imaging and Therapy of Neuroendocrine Tumors https://journal.ugm.ac.id/v3/IJP/article/view/2514 <p class="MDPI17abstract" style="margin: 0cm; margin-bottom: .0001pt; line-height: normal;"><span style="font-size: 12.0pt; font-family: 'Arial','sans-serif';">Somatostatin receptors (SSTRs) are overexpressed in a wide variety of cancers such as neuroendocrine tumors (NETs), but the expression in normal cells is relatively low. Therefore, SSTRs serve a potential target for molecular imaging and <span style="background: white;">therapeutic applications of NETs. This review presents the development of somatostatin analog-labeled with gamma-emitting</span> radionuclides such as <sup>111</sup>In, <sup>99m</sup>Tc, and <sup>123</sup>I for the visualization of NETs via single-photon emission tomography (SPECT). Additionally, the development of somatostatin analog-radiolabeled with positron emitting radionuclide such as <sup>68</sup>Ga for the molecular imaging of NETs with positron emission tomography (PET) is also presented herein. Moreover, this review describes <sup>177</sup>Lu-, <sup>90</sup>Y-, and <sup>111</sup>In-labeled somatostatin analogs as peptide receptor radionuclide therapy (PRRT) agents for the therapeutic application of NETs. These radiolabeled-somatostatin analogs showed promising results with good images quality and high tumor uptake. These results highlight the potential application of radiopharmaceuticals-based somatostatin analogs for the molecular imaging and targeted treatment of NETs. </span></p> Rien Ritawidya Citra Rezza Aurora Putri Palangka Titis Sekar Humani Veronika Yulianti Susilo Ilma Darojatin Anung Pujiyanto Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 333 352 10.22146/ijp.2514 Management of Y-Site Incompatibility of Intravenous Medication: A Systematic Review https://journal.ugm.ac.id/v3/IJP/article/view/2262 <p style="text-align: justify;">Patients in intensive care units have a critical problem with Intravenous (IC) drug administration. The effort to decrease incompatibility or manage the incompatibility risks is paramount significant to reduce morbidity and mortality. This review collates all published studies about kinds of approaches to prevent or solve y-site incompatibility, evaluate the effectiveness of those approaches, and provide the recommendation. A scoping review was conducted in PUBMED in a time frame 1 Januari 2010- 28 February 2021. All type studies of randomised controlled trials, observational studies, before and after studies, also review articled were considered to include. We identified 944 studies; of these, 78 met the inclusion criteria, but 44 were excluded. A total 34 articles were included in the analyses.&nbsp; Six articles reported protocol, two-dimensional chart, database, or pH colour code to provide information of incompatibilities. Two-dimensional chart and pH code were comparable with a gold standard. Specific protocol markedly reduced the incompatibility event. Normal saline (NS) flushing effectively prolonged patency and reduced the incompatibility rate. NS was preferred over heparin associated with thrombocytopenia. In-line filtration has been proved to reduce particulate matter, as well as the precipitation, resulted from incompatibility. The filter also reduced inflammation, infection, and complication appreciably. Four studies used more than three lumen catheters which successfully decrease the number of precipitation and incompatibility events. Therefore, separating incompatible drugs using multi-lumens according to the chart should be preferred. However, when co-administration is inevitable, flushing or filter is needed.</p> Suci Hanifah Patrick Ball Ross A Kennedy Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 353 365 10.22146/ijp.2262 Polyphenols as Tyrosine Kinase Inhibitors for the Treatment of Metastatic Cancers: Current and Future Perspective https://journal.ugm.ac.id/v3/IJP/article/view/3844 <p style="text-align: justify;">Cancer is the world's biggest cause of death as a whole. The higher cancer mortality rate is related to metastasis, which is a major stumbling block in cancer treatment. Polyphenols are a diverse set of antioxidant-rich natural compounds that are often used in cancer treatments as chemopreventives and adjuvants. To find publications that highlight the topic of this review paper, a thorough literature search was conducted in several electronic databases such as PubMed Central, Google Scholar, Scopus, and Medline. Many signaling pathways are involved in the metastatic cascade, including the tyrosine kinase pathway. Tyrosine kinases are a group of enzymes involved in the control of cancer spread. Polyphenols' true role in cancer metastasis remains unappreciated, despite a large body of research proving their antimetastatic effects. As a result, the current work lays out cancer metastasis signaling pathways, stressing the importance of tyrosine kinases in the metastatic process. Polyphenols can suppress tyrosine kinase activity, which contributes to their antimetastatic characteristics. The importance of polyphenols in preventing cancer metastasis by interfering with the tyrosine kinase signaling cascade is highlighted in this work, which could lead to the development of future antimetastatic drugs.</p> Saad Hussain Qasim Mahmood Alhadidi Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 366 380 10.22146/ijp.3844 Analysis of Enoxaparin Effectiveness Based on COVID-19 Severity: A Study in a Secondary Hospital in Bandung, Indonesia https://journal.ugm.ac.id/v3/IJP/article/view/4133 <p>Li Coagulopathy is a common predictor of mortality in COVID-19. Meanwhile, enoxaparin is an anticoagulant with anti-inflammatory, endothelial protection, and viral antagonist properties. Therefore, thromboprophylaxis with enoxaparin in COVID-19 is common in clinical settings. This study aims to assess enoxaparin's efficacy across different severity levels by examining its effect on primary outcomes comprising Length of stay (LOS), invasive mechanical ventilation, and mortality as well as secondary in the form of D-dimer, platelets, C-reactive protein (CRP), Neutrophil Lymphocyte Ratio (NLR), and Absolute Lymphocyte Count (ALC). During hospitalization, 269 patients received enoxaparin across varying severity levels comprising mild, moderate, and severe, while the Wilcoxon test was used to analyze the efficacy in each group. Additionally, the differences in patient characteristic profiles across the severity levels were determined using the Kruskal-Wallis test. The increase in mortality rate and the need for mechanical ventilation were directly proportional to the level of severity. D-dimer decreased from 1308.87 ng/ml to 979.83 ng/ml (p=&lt;0,001) as well as from 1758.41 ng/ml to 1510.68 ng/ml (p=&lt;0,001) in the mild and moderate levels respectively. The platelet increased from 225.65 to 369.39 x10<sup>3</sup>/µl (p=&lt;0,001) in mild and 256.77 to 398.97 x10<sup>3</sup>/µl (p=&lt;0,001) in moderate. Moreover, CRP improved in both mild 52.62 to 49.58 mg/l (p=0.031) and moderate 92.99 to 42.66 mg/l, (p=&lt;0,001). Based on the results, enoxaparin effectively improves D-dimer, platelet, and CRP levels in mild and moderate but not in severe conditions, however, no effect was found on LOS, NLR, and ALC.</p> Budi Suprapti Liana Debora Dewi Kusumawati Arina Dery PS Gabriella Nathasya T Mustika Novi Arini Lusiana Dwi Aryanti Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 381 393 10.22146/ijp.4133 Cocrystals of Cefixime with Nicotinamide: Improved Solubility, Dissolution, and Permeability https://journal.ugm.ac.id/v3/IJP/article/view/2530 <p>Cefixime is a third-generation cephalosporin antibiotic with poor solubility and permeability. The aim was to compared between Dry Grinding (DG) and Liquid-Assisted Grinding (LAG) methods to formed cocrystal of cefixime with nicotinamide. Cocrystal was prepared in 1:1 molar ratio and was characterizated by differential scanning calorimetry (DSC), fourier transform infra-red (FTIR), scanning electron microscopy (SEM), x-ray diffraction (XRD) methods. Cocrystal properties such as solubility, dissolution rate, and permeation rate were evaluated. The solubility test results obtained: 0.420 ± 0.016 (cefixime); 0.675 ± 0.016 (cocrystal 1:1 LAG); and 0.632 ± 0.016 (cocrystal 1:1 DG). The dissolution test results obtained: 186.55 ± 4.18 (cefixime); 232.83 ± 4.07 (cocrystal 1:1 LAG); and 228.82 ± 10.07 (cocrystal 1:1 DG). The permeability test results obtained: 153.58 ± 31.94 (cefixime); 306.22 ± 77.81 (cocrystal 1:1 LAG); and 211.44 ± 22.90 (cocrystal 1:1 DG). Cefixime can be formed into cocrystal with nicotinamide by DG and LAG methods according to the results of characterization using DSC, FTIR, SEM, and XRD accompanied by the increasing solubility, dissolution, and permeability. Cocrystal 1:1 LAG showed better result compared to cocrystal 1:1 DG.</p> Abulkhair Abdullah Mutmainnah Mutmainnah Erindyah R. Wikantyasning Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 394 400 10.22146/ijp.2530 Pharmacists’ Roles and Practices in Pharmaceutical Services During Covid-19 Pandemic: a Qualitative Study https://journal.ugm.ac.id/v3/IJP/article/view/2435 <p>The World Health Organization (WHO) declared COVID-19 a global pandemic on March 11, 2020. Pharmacists as health workers also have an important role in this pandemic. This study wants to look deeper into how pharmacists perceive their role and pharmaceutical services during this pandemic. A qualitative study with Focus Group Discussions (FGDs) was utilized. Fifteen pharmacists from Kepulauan Riau province were involved. They were purposively selected to include pharmacists from the community pharmacies, hospitals, and community health centers. The FGDs were conducted with Zoom meetings and were recorded. The data were then transcribed and analyzed with inductive content analysis.&nbsp; This study found five themes with 18 sub-themes. The five themes are the roles and efforts of pharmacists in managing medicines, medical devices, and disposable medical materials (personal protective equipment); the roles of pharmacists in providing pharmaceutical care; community behaviors during the pandemic; development of pharmacists’&nbsp; roles and capacity during the pandemic; and external factors influencing the roles and practice of pharmacists during the pandemic. During the pandemic, pharmacists continued to work according to their previous roles and adjusted their roles and practice in pharmaceutical services to follow changes in community behaviors. &nbsp;This condition also encouraged pharmacists to develop their roles and capacities. The healthcare management team, the government, and the professional organizations influenced their roles, both positively and negatively. The results of this study provide a deeper understanding of pharmacist roles and practices during the pandemic. This understanding will be useful for the pharmacist in developing their potential and capability to be involved as healthcare professionals, specifically during the pandemic situation and generally in disaster management.</p> Anna Wahyuni Widayanti Shahiroh Haulaini Susi Ari Kristina Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 401 411 10.22146/ijp.2435 Green Technology On The Virgin Coconut Oil Production Using Enzyme From Pineapple Waste https://journal.ugm.ac.id/v3/IJP/article/view/1133 <p style="text-align: justify;">Virgin coconut oil (VCO) is widely used for the pharmaceutical and cosmetic industries. The high lauric acid content is very beneficial in the pharmaceutical field, such as for antiviral and antibiotic. Also, this VCO is very useful for cosmetic formulation. VCO production can be done by several methods, which are chemical, physical, and enzymatic methods. By the increase of VCO demand at the national and international levels, this study proceeded with the production of VCO using an enzymatic way that was efficiently conducted and environmentally friendly. The purpose of this research is to study the enzymatic process of VCO production by using pineapple waste, including pineapple crowns, pineapple fruit skins, pineapple leaves, and pineapple trunks. The pineapple waste used contains the enzyme bromelain to break down protein emulator in coconut milk cream. From the number of experiments with variations in substrate volume and temperature, the optimal VCO formation was obtained at 50<sup>o</sup>C with the ratio between the substrate and enzyme material was 9 to 1. The quality of VCO was evaluated as water content, free fatty acid concentration, and saponification numbers. Based on the evaluation results, the quality of VCO produced was similar to the standard of APCC, SNI, and Codex.</p> Sabtanti Harimurti Naurah Nadhifa Fera Rizki Febrianti Facetha Intan Pramana Sevina Riska Wahita Dyani Primasari Sukamdi Annisa Krisridwany Hari Widada Azura Amid Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 412 421 10.22146/ijp.1133 Synthesis and High Antioxidant Activity of C-Alkyl Calix[4]resorcinarene and C-Alkyl Calix[4]pyrogallolarene Derivatives https://journal.ugm.ac.id/v3/IJP/article/view/2199 <p>In the present work, we reported a successful synthesis and high antioxidant activity of C-alkylcalix[4]resorcinarene and C-alkylcalix[4]pyrogallolarene derivatives. The C-alkylcalix[4]resorcinarenes were prepared from a cyclization reaction of resorcinol and either pentanaldehyde or octanaldehyde in acidic condition. Meanwhile, the C-alkylcalix[4]pyrogallolarenes were prepared from a cyclization reaction of pyrogallol with pentanaldehyde or octanaldehyde. Four synthesized products, i.e. nBu-CR, nHep-CR, nBu-CP, and nHep-CP, were successfully prepared in 92.4-96.4% yield. The chemical structure of these products was elucidated by Fourier transform infrared (FTIR), liquid chromatography-mass spectrometry (LC-MS), and proton nuclear magnetic resonance (<sup>1</sup>H-NMR) analysis. The antioxidant activity assay of these compounds was evaluated through an <em>in vitro</em> assay employing 2,2-diphenyl-1-picrylhydrazyl (DPPH) radicals. From the DPPH assay, it was found that the half-maximal inhibitory concentration (IC<sub>50</sub>) values of nBu-CR, nHep-CR, nBu-CP, and nHep-CP compounds were 25.1, 22.9, 11.5, and 21.9 µg mL<sup>-1</sup>, respectively. The IC<sub>50</sub> value of the synthesized compounds was 2.0-4.3 times lower than the IC<sub>50</sub> value of butylated hydroxytoluene (BHT) as the positive standard (49.9 µg mL<sup>-1</sup>), which is remarkable. This finding demonstrates that either C-alkylcalix[4]resorcinarenes or C-alkylcalix[4]pyrogallolarenes are better antioxidant agents than BHT. The nHep-CR compound was found as the best antioxidant agent from the other compounds due to weaker intramolecular and intermolecular hydrogen bonding as well as longer alkyl chain.</p> Jumina Jumina Yehezkiel Steven Kurniawan Ratna Sari Sri Nessy Handayani Br Purba Hesti Radean Priatmoko Priatmoko Deni Pranowo Bambang Purwono Jeffry Julianus Abdul Karim Zulkarnain Eti Nurwening Sholikhah Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 422 433 10.22146/ijp.2199 Exploring the Potency of Jatropha Seed Meal (Jatropha curcas) as a Chemoprevention Agent through Metastatic Inhibition https://journal.ugm.ac.id/v3/IJP/article/view/3876 <p>Jatropha (<em>Jatropha curcas</em>) is often used as biodiesel because of the oil content in its seeds. The production of jatropha oil generates a byproduct in the form of jatropha seed meal, which contains compounds with cytotoxic activity and phorbol esters, as co-carcinogens and tumor promoters. Meanwhile, metastasis is one of the characteristics of cancer where the cells spread to another tissue. This study aimed to determine the potential of jatropha seed meal as a chemoprevention agent, particularly an antimetastatic one, under bioinformatic study and molecular docking. Genecards and DAVID were performed to explore the protein involved in the metastatic process and its gene ontology. The prediction target protein was caught by SwissTargetPrediction. Jatropha seed meal showed the presence of isoamericanol A, myricetin, daidzein, gallic acid, and rutin. There are 11 prediction target proteins correlated to metastatic in extracellular matrix components. Then we were docked to a protein involved in metastasis, matrix metalloproteinase (MMP)-9 (PDB ID: 6ESM) using MOE software. The docking score determined the interaction properties. The docking analysis revealed that isoamericanol A, daidzein, and myricetin exhibited better binding affinity than native ligands and other compounds. Moreover, based on our literature study, the jatropha seed meal contains isoamericanol A, rutin, myricetin, daidzein, and gallic acid, which present anticancer properties by inhibition of cell invasion and migration, cell cycle arrest induction, and suppression of the MMP-9 activity. Overall, jatropha seed meal has potential as an antimetastatic agent. A comprehensive study is needed to explore the possibility of developing it as a supportive agent in combination with a chemotherapeutic agent.</p> Ana Fiin Nangimi Ahmad Syauqy Tafrihani Midori Rahmadhany Putri Adisusilo Riris Istighfari Jenie Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 434 447 10.22146/ijp.3876 The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy https://journal.ugm.ac.id/v3/IJP/article/view/1970 <p>Gelatin is a hydrocolloid widely used in food products, especially soft candy. It contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a flexible and robust film layer to produce the right product. However, as a Muslim, it must ensure that what is consumed is halal, from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real-time PCR methods. The specific DNA primer design is done with PRIMERQUEST and NCBI software and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity was performed on fresh tissue (cows, pigs, dogs, chickens, goats, and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrome B gene was applied to analyze candies purchased from the market. The method is expected to be specific, sensitive, and reliable for analyzing bovine DNA in candy products. Amplification was also performed on soft candy reference from bovine gelatin. A sensitivity test was performed by measuring amplification at six dilution series (10000, 5000, 1000, 500, 50, and 10 pg) on bovine gelatin candies. The results show that the real-time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 55,2°C. The limit of detection of porcine DNA was 500 pg. The standard curve of the serial dilution of the bovine gelatin DNA isolate produces a correlation coefficient R-value of 0.992 and an efficiency value (E) of 93.1%. Four products from the market were examined by using the primer showed three bovine DNA was detected. Real-time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can be used for the Analysis of halal soft candy.</p> Nina Salamah Yuny Erwanto Sudibyo Martono Abdul Rohman Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 448 454 10.22146/ijp.1970 Characterization of Spray Dried Extract Katuk (Sauropus androgynus) https://journal.ugm.ac.id/v3/IJP/article/view/4443 <p>Katuk (<em>Sauropus androgynus</em>) leaves have been traditionally used in Indonesia for increasing human breast milk production. In the previous research, katuk leaves have high moisture content, therefore katuk leaves extract were being prepared as spray dried <em>S. androgynus</em> extract. The freeze dried leaves were extracted with ultrasonic assisted extraction method using ethanol 80% as a solvent. Then, katuk extract was dried with spray drying method using maltodextrin as a drying aid. To improve the physical characteristics of this extract, it was mixed with mannitol, spray dried lactose, and crospovidone into <em>S. androgynus</em> extract powder. The results showed better physical characteristics, especially on moisture content and flow properties of powders. Metabolic profiles of all samples were analysed by thin layer chromatography (TLC) densitometry method, while the dried extract was dissolved in a suitable solvent and then spotted on GF<sub>254</sub> and the plate was developed using a mixture of n-butanol:acetic acid:water (60:22:1.2). Based on TLC profiles, there are three different spots can be seen clearly at 366 nm on chromatogram of <em>S. androgynus</em> leaves, freeze dried leaves, spray dried leaves extract, and leaves extract powder. There is one spot (S3) at Rf 0.80 which is a stable chemical compound that is not affected by all factors in the entire process in <em>S. androgynus</em> extract powder formulations from extraction, drying, to formulation.</p> Oeke Yunita Agnes Nuniek Winantari Ricky Permana Sugiarto Gunawan Sutanto Prayitna Lie Hwa Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 455 464 10.22146/ijp.4443 Enhancement Peripheral Regeneration as a Target of Potential Diabetic Neuropathy Treatment from Lumbricus rubellus Fraction DLBS1033N: the role of cell viability and migration https://journal.ugm.ac.id/v3/IJP/article/view/4239 <p>Diabetic Peripheral Neuropathy (DPN) significantly affects the quality of life with no definitive therapy currently. Given the pathologic basis for DPN treatment, it's critical to promote neuron regeneration while also restricting nerve degeneration. Schwann cells that play pivotal roles against peripheral regeneration manifest cell proliferation and survival inhibition in diabetic patients consecutively decreased peripheral regeneration capacity. DLBS1033N, a protein hydrolysate obtained from <em>Lumbricus rubellus</em>, has been confirmed to promote Schwann cell line RSC96 growth and survival by induction Nerve Growth Factor (NGF) expression via phosphatidylinositol-3‑kinase (PI3K) pathway. This pathway has an important contribution against Schwann cell proliferation and migration. Herein, the contribution of DLBS1033N to peripheral regeneration on high-glucose (50mM)-induced rat Schwann cell line RSC96 injury, a well-known DPN in vitro cell model.&nbsp;RSC96 were treated with high glucose (50mM) with or without DLBS1033N 25, 50, and 100μg/mL for 24, 48, and 72 h. MTS assay kit were used to evaluate cell viability. DLBS1033N significantly improved cell proliferation in 48 h incubation time with a dose-dependent manner (p &lt; 0.05). Furthermore, DLBS1033N 100μg/ml significantly promoted cell migration by 16% in 48 H incubation (p &lt; 0.05) determined by scratch assay, as the beneficial action to accomplish peripheral regeneration. In conclusion, DLBS1033N enhanced peripheral regeneration which could be used as an effective and promising DPN treatment.</p> Yesiska Kristina Hartanti Agung Endro Nugroho Raymond Rubianto Tjandrawinata Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 465 474 10.22146/ijp.4239 Antibacterial Activity and GC–MS Based Metabolite Profiles of Indonesian Marine Bacillus https://journal.ugm.ac.id/v3/IJP/article/view/3504 <p>Investigating Indonesian marine bacteria producing active compounds is key to finding a cultivable source of marine drugs. Screening the potential strain as well as profiling the active compounds are important steps to identifying the targeted substances. Methods used in this study were isolated some <em>Bacillus </em>strains from several marine environments in Indonesia, evaluated the antibacterial activity, and characterized the secondary metabolite using GC-MS spectroscopy. Several active antimicrobial compounds derived from marine microorganisms were identified using GC-MS such as pyrrolo [1,2-a] pyrazine-1,4-dione, octatriacontyl pentafluoropropionate. We found that some marine bacillus showed antimicrobial activity, such as&nbsp;<em>B. flexus</em>, <em>B. </em><em>t</em><em>equilensis</em>,&nbsp;<em>B subtilis</em>, and<em> Bacillus sp</em>. Profiling of metabolites on GC-MS showed the presence of several bioactive compounds in the ethyl acetate extract, which were identified to be nitrogen compounds such as pyrrolo[1,2-a]pyrazine-1,4-dione, phthalates compounds (butyl isohexyl ester and 1,2 benzendicarboxilate bis (2-etilhexyl) ester), and dibutyl phthalate. Some phenolic compounds also were found, such as tris (2,4-di-ter-butilfenil) fosfat, phenol, 2,4-bis (1,1-dimethyl ethyl), and phenol 3,5-bis (1,1-dimethyl ethyl). Finally, fatty acid derivatives such as n-hexadecanoic acid, cis-vaccenic acid, 7-hexadecene, farnesol isomer A, and stigmastan-3,5-diene were also identified in several marine bacillus. &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p> Tutik Murniasih Murniasih Masteria Yunovilsa P Febriana Untari Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 475 483 10.22146/ijp.3504 Evaluation of trough-based vancomycin therapy in achieving targeted area under the curve in haemodialysis cases. https://journal.ugm.ac.id/v3/IJP/article/view/4433 <p><strong>Background &amp; Objectives:</strong> Recently published IDSA guidelines on vancomycin dosing no longer advocates the use of trough concentrations as surrogate markers for clinical efficacy.&nbsp; Protocols developed prior to revised targets may not reflect to the true efficacy marker for vancomycin that is AUC/MIC 400-600. This study aimed to evaluate the local vancomycin dosing protocol in achieving the target trough concentration and extrapolated AUC/MIC of 400-600 in patients with haemodialysis.</p> <p><strong>Methods: </strong>A retrospective analysis of therapeutic drug monitoring forms and individual medical records of haemodialysis patients was conducted. Vancomycin AUC of each individual was extrapolated via the use of a pharmacokinetic modelling software, PrecisePK<sup>®</sup>. Chi-square test of independence was used to determine the association of factors affecting AUC/MIC. A <em>p</em> value of 0.05 was considered statistically significant.</p> <p><strong>Results:</strong> A total number of 80 haemodialysis-dependent cases who were on vancomycin were recruited. More than 62% of haemodialysis patients showed AUC/MIC &gt; 800. AUC/MIC was heavily influenced by minimum inhibitory concentration of the infecting microorganism. <strong>Interpretation &amp;</strong> <strong>Conclusions:</strong> Exclusive trough-guided dosing may not translate well in achieving clinical efficacy of vancomycin in haemodialysis patients. Other contributing factors, especially MIC should be factored, as small MIC values account for greater reciprocal AUC/MIC values that increase the risk of loss of residual kidney function; a factor which is associated with overall mortality of HD patients.</p> Fazlollah Keshavarzi Vithyah Nadaraja Aliza Alias Muhammad Junaid Farrukh Chuan Sheng Yap Copyright (c) 2022 Indonesian Journal of Pharmacy https://creativecommons.org/licenses/by/2.0/ 2022-09-28 2022-09-28 484 492 10.22146/ijp.4433