Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development

https://doi.org/10.22146/jsv.44696

Narendra Yoga Hendarta(1*), Asmarani Kusumawati(2), Tri Wibawa(3), Abu Tholib Aman(4)

(1) Department of Medical Laboratory Technology, Politeknik Kesehatan Kementerian Kesehatan Yogyakarta
(2) Department of Reproduction and Obstetrics, Faculty of Veterinary Medicine, Universitas Gadjah Mada
(3) Department of Microbiology, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada
(4) Department of Microbiology, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada
(*) Corresponding Author

Abstract


Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.

Keywords : capture probe; dengue virus;  hybridization; nucleic acid lateral flow; serotyping

Keywords


capture probe; dengue virus; hybridization; nucleic acid lateral flow; serotyping

Full Text:

PDF


References

Anggraini, Y.M. (2016). Development of lateral flow immunoassay as detection tool of isothermal amplification of dengue virus. Thesis. S2 Biotechnology Program, Graduate School, Gadjah Mada University.

Blacksell, S.D., Mammen, M.P.Jr., Thongpaseuth, S., Gibbons, R.V., Jarman, R.G., Jenjaroen, K., Nisalak, A., Phetsouvanh, R., Newton, P.N. and Day, N.P. (2008). Evaluation of the panbio dengue virus nonstructural 1 antigen detection and im-munoglobulin m antibody enzyme-linked immunosorbent assays for diagnosis of acute infections in Laos. Diagn Microbiol Infect Dis., 60(1):43-49.

de-Muro, M.A. (2005). Probe Design, Production, and Applications. In Medical Biomethods Handbook, 2005, Walker, J.M. and Rapley, R. (Ed). Humana Press, New Jersey, pp. 13-23

Ding, W.C., Chen, J., Shi, Y.H., Lu, X.J. and Li, M.Y. (2010). Rapid and sensitive detection of infectious spleen and kidney necrosis virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. Arch Virol. ,155:385-389.

Duong, V., Ly, S., Lorn-Try, P., Tuiskunen, A., Ong, S., Chroeung, N., Lundkvist, A., Leparc-Goffart, I., Deubel, V.,Vong, S. and Buchy, P. (2011). Clinical and virological factors influencing the performance of a ns1 antigen-capture assay and potential use as a marker of dengue disease severity. PLoS Negl Trop Dis., 5:e1244.

Farrell-Jr, R.E. (2010). A Laboratory Guide for Isolation and Characterization. In Practical Nucleic Acid Hybridization in RNA Methodologies. Farrell-Jr, R.E. (Ed). 4th ed, Academic Press, New York. p. 287

Gurukumar, K.R., Priyadarshini, D., Patil, J.A., Bhagat, A., Singh, A., Shah, P.S., and Cecilia, D., (2009). Development of real time PCR for detection and quantitation of dengue viruses. Virol J., 6(10).

Hamid, P.H. Hendarta, N.Y., Widyasari, A. and Purwanti. (2011). Dipstick Prototype NAFL for Rapid Diagnosis Affirmation of Dengue Fever Based on Serotype DEN Virus-Specific Which Is Circulating in Indonesia: A Report of Hibah Penelitian Strategis Nasional. Yogyakarta.

Harris, E., Roberts, T.G., Smith, L., Selle, J., Kramer, L.D., Valle, S., Sandoval, E. and Balmaseda, A. (1998). Typing of dengue viruses in clinical specimens and mosquitoes by single-tube multiplex reverse transcriptase PCR. J Clin Microbiol., 36(9):2634-2639.

Haslam, N.J., Whiteford, N.E., Weber, G., Prugel-Bennett, A, Essex, J.W., and Neylon, C. (2008). Optimal probe length varies for targets with high sequence variation: implications for probe library design for resequencing highly variable genes. PLoS One. 3(6):e2500.

Hendarta, N.Y., Tampubolon, I.D. and Helmyati, S. (2012). Development of Miltiplex Dipstick for Early Detection of HIV-1 and HBV Based on the Combination of Multiplex Reverse Transcription Loop Mediated Isothermal Amplification (mRT-LAMP) and Lateral Flow Dipstick (LFD): RISBINIPTEKDOK Reports. Yogyakarta.

Idoko, M.O., Ado, S.A., Veronica, J., and Umoh, V.J. (2014). Serological Survey of Dengue Virus Immunoglobulin M Among Febrile Patients in Kaduna Metropolis, Nigeria. Aceh Int. J. Sci. Technol., 3(3): 152-158.

Kane, M.D., Jatkoe, T.A., Stumpf, C.R., Lu, J., Thomas, J.D., Madore, S.J. (2000). Assessment of the sensitivity and specificity of oligonucleotide (50mer) microarrays. Nucleic Acids Res., 28:4552–4557.

Kao, C.L., King, C.C., Chao D.Y., Wu, H.L. and Chang, G.J. (2005). Laboratory diagnosis of dengue virus infection: current and future perspectives in clinical diagnosis and public health. J Microbiol Immunol Infect. 2005;38(1):5-16.

Koehler, R.. and Peyret, N. (2005). Thermodynamic properties of DNA sequences: characteristic values for the human genome. Bioinformatics, 21(16):3333–3339.

Kucho, K., Yoneda, H., Harada, M. and Ishiura, M. (2004). Determinants of sensitivity and specificity in spotted DNA microarrays with unmodified oligonucleotides. Genes Genet Syst., 79:189-197.

Kusumawati, A., Tampubolon, I.D., Hendarta, N.Y., Salasia, S.I., Wanahari, T.A., Mappakaya, B.A. and Hartati, S. (2015). Use of reverse transcription loop-mediated isothermal amplification combined with lateral flow dipstick for an easy and rapid detection of Jembrana disease virus. Virusdisease., 26(3):189-95. doi: 10.1007/s13337-015-0277-5

Kusumawati, A. and Fatimah. (2018). Combination of One-Step Reverse Transcription Polymerase Chain Reaction (RT-PCR) and NALF (Nucleic Acid Lateral Flow) Method to Detect env-tm Gene of Jembrana Virus Tabanan 1987 strain. Jurnal Sain Veteriner, 36(2): 137-143

Lanciotti, R.S., Calisher, C.H., Gubler, D.J., Chang, G.J. and Vorndam, V. (1992). Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J Clin Microbiol., 30:545-551.

Mardekian, S.K. and Robert, A.M. (2015). Review article: Diagnostic options and challenges for dengue and chikungunya viruses. Biomed Res Int., doi:10.1155/2015/834371.

Nimitphak , T., Meemetta, W., Arunrut, N., Senapin, S., Kiatpathomchai, W. (2010). Rapid and sensitive detection of Penaeus monodon Nucleopolyhedrovirus (PemoNPV) by loop-mediated isothermal amplification combined with a lateral flow dipstick. Mol Cell Probes. , 241:1-5.

Rodenhuis-Zybert, I.Z., Wilschut, J., Smit, J.M. (2010). Dengue virus life cycle: viral and host factors modulating infectivity. Cell Mol Life Sci., 67:2773–2786.

Rule, G.S., Montagna, R.A., Durst, R.A. (1996). Rapid method for visual identification of specific DNA sequences based on DNA-tagged liposomes, ClinicalChemistry,42:8, 1206-1209

Sahni, A.K., Grover, N., Sharma, A., Khan, I.D., Kishore, J. (2013). Reverse transcription loop-mediated isothermal amplification (RT-LAMP) for diagnosis of dengue. Med J Armed Forces India, 69(3):246-253.

Sambrook, J. and Russel, D.W. (2001). Molecular Cloning: A Laboratory Manual vol.1. 3rd ed. Cold Spring Harbor Laboratory Press, New York, p. 10.2

Shepard, D.S., Undurraga, E.A., Lees, R.S., Halasa, Y.A., See-Lum, L.C., Wan-Ng, C. (2012). Use of multiple data sources to estimate the economic cost of dengue illness in Malaysia. Am J Trop Med Hyg., (87):796-805.

Vázquez, S., Cabezas, S., Pérez, A.B., Pupo, M., Ruiz, D., Calzada, N., Bernardo, L., Castro, O., González, D., Serrano, T., Sanchez, A., and Guzmán, M.G. (2007). Kinetics and antibodies in sera, saliva and urine samples from adult patients with primary or secondary dengue 3 virus infections. Int J Infect Dis. 11:256-262.

Vorndam, V. and Kuno, G. (1997). Laboratory Diagnosis of Dengue Viruses Infections, in Dengue and Dengue Haemorrhagic Fever. Gubler, D,J. and Kuno, G. eds. CAB International, New York.

Whiteford, N., Haslam N., Weber , G., Prugel-Bennett, A., Essex, J.W. (2005). An analysis of the feasibility of short read sequencing. Nucl Acids Res. 33(19):e171.

WHO. Dengue and severe dengue. (2014) World Health Organization. https://www.who.int/en/news-room/fact-sheets/detail/dengue-and-severe-dengue. Retrieved on February 10, 2016

Widayanti, R., Kusumawati ,A., Hendarta, N.Y. (2012). Rapid Detection Dipstick for Early Diagnosis of Jembrana Disease Based on the Combination of Loop Mediated Isothermal Amplification (LAMP) and Lateral Flow Dipstick (LFD): A Report of Hibah Fundamental Study. Yogyakarta.

Wu, S.J., Lee, E.M., Putvatana, R., Shurtliff, R.N., Porter, K.R., Suharyono, W., Watts, D.M., King, C.C., Murphy, G.S., Hayes, C.G., Romano, J.W. (2001). Detection of dengue viral RNA using a nucleic acid sequence-based amplification assay. J Clin Microbiol., 39(8):2794-2798.

Yap. G., Sil, B.K., Ng, L.C. (2011). Use of saliva for early dengue diagnosis. PLoS Negl Trop Dis., 5(5):e1046.

Yong, Y.K., Thayan. R., Chong, H.T., Tan, C.T., Sekaran, S.D. (2007). A simple one-step real-time rt-pcr for diagnosis of dengue virus infection. Singapore Med J., 48(7):662-668.



DOI: https://doi.org/10.22146/jsv.44696

Article Metrics

Abstract views : 2381 | views : 2018

Refbacks

  • There are currently no refbacks.




Copyright (c) 2021 Jurnal Sain Veteriner

Creative Commons License
This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

Jurnal Sain Veteriner Indexed by

    CrossrefROADCOREProduct DetailsDESKRIPSI GAMBAR


Copyright of JSV (Jurnal Sain Veteriner) ISSN 0126-0421 (print), ISSN 2407-3733 (online).

Fakultas Kedokteran Hewan, Universitas Gadjah Mada

Jl. Fauna No.2, Karangmalang, Yogyakarta

Phone: 0274-560862

Fax: 0274-560861

Email: jsv_fkh@ugm.ac.id

HP. 0895363078367

Jurnal Sain Veteriner is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

 

free
web stats View My Stats