The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy
DOI:
https://doi.org/10.22146/ijp.1970Keywords:
primer mitochondrial cytochrome B gene, bovine DNA, gelatin, real-time PCRAbstract
Gelatin is a hydrocolloid widely used in food products, especially soft candy. It contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a flexible and robust film layer to produce the right product. However, as a Muslim, it must ensure that what is consumed is halal, from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real-time PCR methods. The specific DNA primer design is done with PRIMERQUEST and NCBI software and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity was performed on fresh tissue (cows, pigs, dogs, chickens, goats, and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrome B gene was applied to analyze candies purchased from the market. The method is expected to be specific, sensitive, and reliable for analyzing bovine DNA in candy products. Amplification was also performed on soft candy reference from bovine gelatin. A sensitivity test was performed by measuring amplification at six dilution series (10000, 5000, 1000, 500, 50, and 10 pg) on bovine gelatin candies. The results show that the real-time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 55,2°C. The limit of detection of porcine DNA was 500 pg. The standard curve of the serial dilution of the bovine gelatin DNA isolate produces a correlation coefficient R-value of 0.992 and an efficiency value (E) of 93.1%. Four products from the market were examined by using the primer showed three bovine DNA was detected. Real-time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can be used for the Analysis of halal soft candy.
References
Cai, S., Kong, F., & Xu, S. (2020). Detection of porcine-derived ingredients from adulterated meat based on real-time loop-mediated isothermal amplification. Molecular and Cellular Probes, 53(January), 101609. https://doi.org/10.1016/j.mcp.2020.101609
Cebi, N., Durak, M. Z., Toker, O. S., Sagdic, O., & Arici, M. (2016). An evaluation of Fourier transforms infrared spectroscopy method for the classification and discrimination of bovine, porcine and fish gelatins. Food Chemistry, 190, 1109–1115. https://doi.org/10.1016/j.foodchem.2015.06.065
Cheng, X. L., Wei, F., Xiao, X. Y., Zhao, Y. Y., Shi, Y., Liu, W., Zhang, P., Ma, S. C., Tian, S. S., & Lin, R. C. (2012). Identification of five gelatins by ultra performance liquid chromatography/time-of-flight mass spectrometry (UPLC/Q-TOF-MS) using principal component analysis. Journal of Pharmaceutical and Biomedical Analysis, 62, 191–195. https://doi.org/10.1016/j.jpba.2011.12.024
Erwanto, Y., Rohman, A., Arsyanti, L., & Pranoto, Y. (2018). Identification of pig DNA in food products using polymerase chain reaction (PCR) for halal authentication-a review. International Food Research Journal, 25(4).
Hossain, M. A. M., Uddin, S. M. K., Chowdhury, Z. Z., Sultana, S., Johan, M. R., Rohman, A., Erwanto, Y., & Ali, M. E. (2019). Universal mitochondrial 16s rRNA biomarker for mini-barcode to identify fish species in Malaysian fish products. Food Additives and Contaminants - Part A Chemistry, Analysis, Control, Exposure and Risk Assessment, 36(4), 493–506. https://doi.org/10.1080/19440049.2019.1580389
Huang, Y., Li, T., Deng, G., Guo, S., & Zaman, F. (2020). Recent advances in animal origin identification of gelatin-based products using liquid chromatography-mass spectrometry methods: A mini review. Reviews in Analytical Chemistry, 39(1), 260–271. https://doi.org/10.1515/revac-2020-0121
Ismail, A. M., Sani, M. S. A., Azid, A., Zaki, N. N. M., Arshad, S., Tukiran, N. A., Abidin, S. A. S. Z., Samsudin, M. S., & Ismail, A. (2021). Food forensics on gelatine source via ultra-high-performance liquid chromatography diode-array detector and principal component analysis. SN Applied Sciences, 3(1). https://doi.org/10.1007/s42452-020-04061-7
Jansson, L., Koliana, M., Sidstedt, M., & Hedman, J. (2017). Blending DNA binding dyes to improve detection in real-time PCR. Biotechnology Reports, 14, 34–37. https://doi.org/10.1016/j.btre.2017.02.002
Lee, S. B., Mccord, B., & Buel, E. (2014). Advances in forensic DNA quantification: A review. Electrophoresis, 35(21–22), 3044–3052. https://doi.org/10.1002/elps.201400187
Lubis, H., Salihah, N. T., Norizan, N. A., Hossain, M. M., & Ahmed, M. U. (2018). Fast and sensitive real-time PCR-based detection of porcine DNA in food samples by using EvaGreen Dye. Food Science and Technology Research, 24(5), 803–810. https://doi.org/10.3136/fstr.24.803
Matsunaga, T., Chikuni, K., Tanabe, R., Muroya, S., Shibata, K., & Yamada, J. (1999). A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Science, 51, 143–148.
Nemati, M., Oveisi, M. R., Abdollahi, H., & Sabzevari, O. (2004). Differentiation of bovine and porcine gelatins using principal component analysis. Journal of Pharmaceutical and Biomedical Analysis, 34(3), 485–492. https://doi.org/10.1016/S0731-7085(03)00574-0
Nur Azira, T., Che Man, Y. B., Raja Mohd Hafidz, R. N., Aina, M. A., & Amin, I. (2014). Use of principal component analysis for differentiation of gelatine sources based on polypeptide molecular weights. Food Chemistry, 151, 286–292. https://doi.org/10.1016/j.foodchem.2013.11.066
Orbayinah, S., Widada, H., Hermawan, A., Sudjadi, S., & Rohman, A. (2019). Application of real-time polymerase chain reaction using species specific primer targeting on mitochondrial cytochrome-b gene for analysis of pork in meatball products. Journal of Advanced Veterinary and Animal Research, 6(2), 260–265. https://doi.org/10.5455/javar.2019.f342
Pratiwi, D., Fitriani, N. E., Sudjadi, Rohman, A., Erwanto, Y., Rohman, A., Arsyanti, L., & Pranoto, Y. (2018). Identification of pig DNA in food products using polymerase chain reaction (PCR) for halal authentication-a review. International Food Research Journal, 25(4), 1515–1519.
Rohman, A., Himawati, A., Triyana, K., Sismindari, & Fatimah, S. (2017). Identification of pork in beef meatballs using Fourier transform infrared spectrophotometry and real-time polymerase chain reaction. International Journal of Food Properties, 20(3). https://doi.org/10.1080/10942912.2016.1174940
Rohman, Abdul, & Windarsih, A. (2020). The application of molecular spectroscopy in combination with chemometrics for halal authentication analysis: A review. International Journal of Molecular Sciences, 21(14), 1–18. https://doi.org/10.3390/ijms21145155
Rohman, Abdul, Windarsih, A., Erwanto, Y., & Zakaria, Z. (2020). Review on analytical methods for analysis of porcine gelatine in food and pharmaceutical products for halal authentication. Trends in Food Science and Technology, 101(May), 122–132. https://doi.org/10.1016/j.tifs.2020.05.008
Sudjadi, Wardani, H. S., Sepminarti, T., & Rohman, A. (2016). Analysis of Porcine Gelatin DNA in a Commercial Capsule Shell Using Real-Time Polymerase Chain Reaction for Halal Authentication. International Journal of Food Properties, 19(9). https://doi.org/10.1080/10942912.2015.1110164
Sultana, S., Hossain, M. A. M., Zaidul, I. S. M., & Ali, M. E. (2018). Multiplex PCR to discriminate bovine, porcine, and fish DNA in gelatin and confectionery products. LWT - Food Science and Technology, 92(February), 169–176. https://doi.org/10.1016/j.lwt.2018.02.019
Widyasari, Y. I., Sudjadi, & Rohman, A. (2015). Detection of rat meat adulteration in meat ball formulations employing real time PCR. Asian Journal of Animal Sciences, 9(6), 460–465. https://doi.org/10.3923/ajas.2015.460.465
Yilmaz, M. T., Kesmen, Z., Baykal, B., Sagdic, O., Kacar, O., Yetim, H., & Baykal, A. T. (2013). A novel method to differentiate bovine and porcine gelatins in food products: NanoUPLC-ESI-Q-TOF-MSE based data independent acquisition technique to detect marker peptides in gelatin. Food Chemistry, 141(3), 2450–2458. https://doi.org/10.1016/j.foodchem.2013.05.096


