CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon)

https://doi.org/10.22146/ijc.21388

Tri Joko Raharjo(1*), Rosyida Azis Rizki(2), Stalis Norma Ethica(3), Elly Rustanti(4), L. Hartanto Nugroho(5)

(1) Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Gadjah Mada, Yogyakarta, Jl. Sekip Utara, Yogyakarta
(2) Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Gadjah Mada, Yogyakarta, Jl. Sekip Utara, Yogyakarta
(3) Biotechnology Study Program, Universitas Gadjah Mada, Jalan Teknika Utara, Yogyakarta
(4) Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Gadjah Mada, Yogyakarta, Jl. Sekip Utara, Yogyakarta
(5) Biology Department, Universitas Gadjah Mada, JalanSekip Utara, Yogyakarta
(*) Corresponding Author

Abstract


Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Keywords


Resveratrol; stilbene synthase gene (sts); RT-PCR; Gnetum gnemon L.

Full Text:

Full Text PDF


References

[1] Opipari, A.W., Tan, L., Boitano, A.E., Sorenson, D.R., Aurora, A., and Liu, J.R., 2004, Cancer Res., 64, 2, 696–703.

[2] Ding, X.Z., and Adrian, T.E., 2002, Pancreas, 25, 4, 71–76.

[3] Holian, O., Wahid, S., Atten, M.J., and Attar, B.M., 2002, Am. J. Physiol., 282, 5, 809–816.

[4] Kozuki, Y., Miura, Y., and Yagasaki, K., 2001, Cancer Lett., 167, 2, 151–156.

[5] Wang, W., Tang, K., Yang, H-R., Wen, P-F., Zhang, P., Wang, H-L., and Huang, W-D., 2010, Plant Physiol. Biochem., 48, 2-3, 142–152.

[6] Chen, R.S., Wu, P.L., and Chiou, R.Y., 2002, Peanut Roots As A Source of Resveratrol, J. Agric. Food Chem., 50, 6, 1665–1667.

[7] Chung, I-M., Park, M.R., Chun, J.C., and Yun S.J., 2003, Plant Sci., 164, 1, 103–109.

[8] Leiro, J., Ezequiel, A., Juan A., Reyes, L., Eugenio, U., and Francisco, O., 2004, J. Leukocyte Biol., 75, 6, 1156–1165.

[9] Deak, M., and Falk, H., 2003, Monatsh. Chem., 134, 6, 883–888.

[10] Gorham, J., 1995, The Biochemistry of The Stilbenoids, Chapman & Hall, London.

[11] Halls, C., and Yu, O., 2008, Trends Biotechnol., 26, 2, 77–81.

[12] Richter, H., Pezet, R., Viret, O., and Gindro, K., 2006, Physiol. Mol. Plant Pathol., 67, 3-5, 248–26

[13] Raiber, S., Schröder, G., and Schröder, J., 1995, FEBS Lett., 361, 2-3, 299–302.

[14] Shin, S-Y., Han, N.S., Park, Y-C., Kim, M-D., and Seo, J-H., 2011, Enzyme Microb. Technol., 48, 1, 48–53.

[15] White, E., 2009, Basic Biotechnol., 5, 1, 84–90.

[16] Illiya, I., Ali Z., Tanaka, T., Iinuma, M., Furusawa, M., Nakaya, K., Murata, J., Darnaedi, D., Matsuura, N., and Ubukata, M., 2003, Phytochemistry, 62, 4, 601–606.

[17] Rustanti, E., 2011, Karakterisasi Fragmen 0,45 kb Gen Pengkode Stilben Sintase dari Tanaman Melinjo (Gnetum gnemon L.), Thesis, Chemistry Department, Faculty of Mathematics and Natural Sciences, Universitas Gadjah Mada, Yogyakarta.



DOI: https://doi.org/10.22146/ijc.21388

Article Metrics

Abstract views : 3748 | views : 1983


Copyright (c) 2011 Indonesian Journal of Chemistry

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

 


Indonesian Journal of Chemistry (ISSN 1411-9420 /e-ISSN 2460-1578) - Chemistry Department, Universitas Gadjah Mada, Indonesia.

Web
Analytics View The Statistics of Indones. J. Chem.