The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

https://doi.org/10.22146/ijc.60413

Nina Salamah(1), Yuny Erwanto(2), Sudibyo Martono(3), Abdul Rohman(4*)

(1) Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia; Department of Analytical Chemistry, Faculty of Pharmacy, Universitas Ahmad Dahlan, Jl. Prof Soepomo, Janturan Yogyakarta 55164, Indonesia; Ahmad Dahlan Halal Center, Universitas Ahmad Dahlan, Jl. Prof Soepomo, Janturan Yogyakarta 55164, Indonesia
(2) Division of Animal Products Technology, Faculty of Animal Science, Universitas Gadjah Mada, Jl. Fauna No. 3, Bulaksumur, Yogyakarta 55281, Indonesia; Research Centre of Halal Products, Universitas Gadjah Mada, Jl. Kaliurang Km 4, Sekip, Yogyakarta 55281, Indonesia
(3) Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia
(4) Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Universitas Gadjah Mada, Yogyakarta, 55281, Indonesia; Research Centre of Halal Products, Universitas Gadjah Mada, Jl. Kaliurang Km 4, Sekip, Yogyakarta 55281, Indonesia
(*) Corresponding Author

Abstract


Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Keywords


primer D-loop; porcine DNA; real-time PCR; halal authentication

Full Text:

Full Text PDF


References

[1] Ali, M.E., Kashif, M., Uddin, K., Hashim, U., Mustafa, S., and Che Man, Y.B., 2012, Species authentication methods in foods and feeds: The present, past, and future of halal forensics, Food Anal. Methods, 5 (5), 935–955.

[2] Rahman, M.M., Ali, M.E., Abd Hamid, S.B., Mustafa, S., Hashim, U., and Hanapi, U.K., 2014, Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation, Meat Sci., 97 (4), 404–409.

[3] Cebi, N., Durak, M.Z., Toker, O.S., Sagdic, O., and Arici, M., 2016, An evaluation of Fourier transforms infrared spectroscopy method for the classification and discrimination of bovine, porcine and fish gelatins, Food Chem., 190, 1109–1115.

[4] Kurniati, E., Rohman, A., and Triyana, K., 2014, Analysis of lard in meatball broth using Fourier transform infrared spectroscopy and chemometrics, Meat Sci., 96 (1), 94–98.

[5] Nemati, M., Oveisi, M., Abdollahi, H., and Sabzevari, O., 2004, Differentiation of bovine and porcine gelatins using principal component analysis, J. Pharm. Biomed. Anal., 34 (3), 485–492.

[6] Zang, G.F., Liu, T., Wang, Q., Lei, J.D., Ma, G.H., and Su, Z.G., 2008, Identification of marker peptides in digested gelatins by high performance liquid chromatography/mass spectrometry, Chin. J. Anal. Chem., 36 (11), 1499–1504.

[7] Doi, H., Watanabe, E., Shibata, H., and Tanabe, S., 2009, A reliable enzyme linked immunosorbent assay for the determination of bovine and porcine gelatin in processed foods, J. Agr. Food. Chem., 57 (5), 1721–1726.

[8] Pereira, F., Carneiro, J., and Amorim, A., 2008, Identification of species with DNA-based technology: Current progress and challenges, Recent Pat. DNA Gene Sequences, 2 (3), 187–199.

[9] Maryam, S., Sismindari, Raharjo, T.J., Sudjadi, and Rohman, A., 2016, Analysis of porcine contamination in laboratory prepared dendeng using mitochondrial D-loop686 and cytb gene primers by real time polymerase chain reaction, Int. J. Food Prop., 19 (1), 187–195.

[10] Arini, R.L., Ramadhani, D., Pebriyanti, N.W., Sismindari, and Rohman, A., 2018, The use of species-specific primer targeting on D-loop mitochondrial for identification of wild boar meat in meatball formulation, J. Adv. Vet. Anim. Res., 5 (3), 361–368.

[11] Aina, G.Q., Erwanto, Y., Hossain, M., Johan, M.R., Ali, M.E., and Rohman, A., 2019, The employment of q-PCR using specific primer targeting on mitochondrial cytochrome-b gene for identification of wild boar meat in meatball samples, J. Adv. Vet. Anim. Res., 6 (3), 300–307.

[12] Ali, M.E., Razzak, M.A., Hamid, S.B.A., Rahman, M.M., Rashid, N.R.A., and Asing, 2015, Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods, Food. Chem., 177, 214–224.

[13] Sudjadi, Wardani, S., Sepminarti, T., and Rohman, A., 2016, Analysis of porcine gelatin DNA in commercial capsule shell using real-time polymerase chain reaction for halal authentication, Int. J. Food Prop., 19 (9), 2127–2134.

[14] Raraswati, M.A., Triyana, K., and Rohman, A., 2014, Differentiation of bovine and porcine gelatins in food products based on amino acid profiles and chemometrics, J. Food Pharm. Sci., 2 (1), 23–26.

[15] Sambrook, J., Fritsch, E.F., and Maniatis, T.A., 1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.

[16] Codes Alimentarius, 2010, CAC/GL 74-2010 Guidelines on Performance Criteria and Validation of Methods for Detection, Identification and Quantification of Specific DNA Sequences and Specific Proteins in Foods, http://www.codex alimentarius.org/standards/list-of-standards/.

[17] Bio-Rad, 2006, Real Time PCR Application Guide, Bio-Rad Laboratories, Inc., USA.

[18] Borah, P., 2011, Primer designing for PCR, Sci. Vis., 11 (3), 134–136.

[19] Fajardo, V., Gonzalez, I., Rojas, M., Garcia, T., and Martin, R., 2010, A review of current PCR-based methodologies for authentication of meats from game animal species, Trends Food Sci. Technol., 21 (8), 408–421.

[20] Nadeau, J., 2011, Introduction to Experimental Biophysics: Biological Methods for Physical Scientists, 1st Ed., CRC Press, Boca Raton, FL.

[21] Stanta, G., 2011, Guidelines for Molecular Analysis in Archive Tissues, Springer-Verlag Berlin Heidelberg.

[22] ICH, 2005, Q 2 (R1) Validation of Analytical Procedures, Text and Methodology 15, European Medicines Agency, London, UK.



DOI: https://doi.org/10.22146/ijc.60413

Article Metrics

Abstract views : 6060 | views : 4228


Copyright (c) 2021 Indonesian Journal of Chemistry

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

 


Indonesian Journal of Chemistry (ISSN 1411-9420 /e-ISSN 2460-1578) - Chemistry Department, Universitas Gadjah Mada, Indonesia.

Web
Analytics View The Statistics of Indones. J. Chem.